 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circ-PAX2 | |||
| Gene | PAX2 | Organism | Human |
| Genome Locus | chr10:102539254-102541122:+ | Build | hg19 |
| Disease | Lung Squamous Cell Carcinoma (LSCC) | ICD-10 | Lung squamous cell carcinoma (LSCC) (D02.2) |
| DBLink | Link to database | PMID | http://www.ijcep.com/files/ijcep0078547.pdf |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | 86 paired LSCC and marched noncancerous tissues |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward CATCCGGACCAAAGTTCAGCA ReverseCTATGGCTACAGTAGCACCAAG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| http://www.ijcep.com/files/ijcep0078547.pdf | |||